Review



hrp phlip fusion protein  (Biotechnology Information)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Biotechnology Information hrp phlip fusion protein
    Hrp Phlip Fusion Protein, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hrp+phlip+fusion+protein/fusion+hrp+phlip+protein/pm41533781-274-20-14
    Average 86 stars, based on 1 article reviews
    hrp phlip fusion protein - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Cloning:

    Article Title: On-demand cancer immunotherapy via single-cell encapsulation of synthetic circuit-engineered cells.
    Article Snippet: .. Gene cloning, protein expression, and purification The target genes encoding HRP (National Center for Biotechnology Information accession: HW399451.1) and the HRP- pHLIP fusion protein were custom synthesized by Genewiz Inc. (Suzhou, China), with the pHLIP domain containing the optimized nucleotide sequence: 5′- GCGGAGCAGAACCCGATTTATTGGGCGCGCTAT GCGGATTGGCTGTTTACCACCCCGCTGTTACTGCTGGATCTGGCGCTGCTGGTGGATGCGGATGAAGGCACC- 3′. ..

    Expressing:

    Article Title: On-demand cancer immunotherapy via single-cell encapsulation of synthetic circuit-engineered cells.
    Article Snippet: .. Gene cloning, protein expression, and purification The target genes encoding HRP (National Center for Biotechnology Information accession: HW399451.1) and the HRP- pHLIP fusion protein were custom synthesized by Genewiz Inc. (Suzhou, China), with the pHLIP domain containing the optimized nucleotide sequence: 5′- GCGGAGCAGAACCCGATTTATTGGGCGCGCTAT GCGGATTGGCTGTTTACCACCCCGCTGTTACTGCTGGATCTGGCGCTGCTGGTGGATGCGGATGAAGGCACC- 3′. ..

    Purification:

    Article Title: On-demand cancer immunotherapy via single-cell encapsulation of synthetic circuit-engineered cells.
    Article Snippet: .. Gene cloning, protein expression, and purification The target genes encoding HRP (National Center for Biotechnology Information accession: HW399451.1) and the HRP- pHLIP fusion protein were custom synthesized by Genewiz Inc. (Suzhou, China), with the pHLIP domain containing the optimized nucleotide sequence: 5′- GCGGAGCAGAACCCGATTTATTGGGCGCGCTAT GCGGATTGGCTGTTTACCACCCCGCTGTTACTGCTGGATCTGGCGCTGCTGGTGGATGCGGATGAAGGCACC- 3′. ..

    Synthesized:

    Article Title: On-demand cancer immunotherapy via single-cell encapsulation of synthetic circuit-engineered cells.
    Article Snippet: .. Gene cloning, protein expression, and purification The target genes encoding HRP (National Center for Biotechnology Information accession: HW399451.1) and the HRP- pHLIP fusion protein were custom synthesized by Genewiz Inc. (Suzhou, China), with the pHLIP domain containing the optimized nucleotide sequence: 5′- GCGGAGCAGAACCCGATTTATTGGGCGCGCTAT GCGGATTGGCTGTTTACCACCCCGCTGTTACTGCTGGATCTGGCGCTGCTGGTGGATGCGGATGAAGGCACC- 3′. ..

    Sequencing:

    Article Title: On-demand cancer immunotherapy via single-cell encapsulation of synthetic circuit-engineered cells.
    Article Snippet: .. Gene cloning, protein expression, and purification The target genes encoding HRP (National Center for Biotechnology Information accession: HW399451.1) and the HRP- pHLIP fusion protein were custom synthesized by Genewiz Inc. (Suzhou, China), with the pHLIP domain containing the optimized nucleotide sequence: 5′- GCGGAGCAGAACCCGATTTATTGGGCGCGCTAT GCGGATTGGCTGTTTACCACCCCGCTGTTACTGCTGGATCTGGCGCTGCTGGTGGATGCGGATGAAGGCACC- 3′. ..



    Similar Products

    hrp phlip fusion protein  (Biotechnology Information)
    86
    Biotechnology Information hrp phlip fusion protein
    Hrp Phlip Fusion Protein, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hrp+phlip+fusion+protein/fusion+hrp+phlip+protein/pm41533781-274-20-14
    Average 86 stars, based on 1 article reviews
    hrp phlip fusion protein - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results